[ Program Manual | User's Guide | Data Files | Databases ]
MeltTemp computes the melting temperature of oligonucleotides. You can provide the oligonucleotide sequences in a file or simply type them in at the keyboard.
MeltTemp determines the melting temperature of an oligonucleotide by a calculation using the nearest-neighbor model of Borer, and thermodynamic parameters for DNA nearest-neighbor interactions and the salt dependence of oligonucleotides determined by SantaLucia (Proc.Natl. Acad. Sci. USA. 95; 1460-1465 (1998)). MeltTemp also lists the percent G+C content of an oligonucleotide.
MeltTemp does not read the GCG sequence file format. Sequences must be typed in interactively from the keyboard or provided in a file whose format is described later under the INPUT FILES topic.
Here is a session using MeltTemp to determine the melting temperature of three oligonucleotides:
% melttemp
Enter oligonucleotides individually, one per line.
End the list with a blank line.
Oligo 1: acccttcagcagttccacac
Oligo 2: aagcacccttcagcagttcc
Oligo 3: aagagaggtggaaatgagg
Oligo 4:
What should I call the output file name (* oligos.melttemp *) ?
Computing melting temperature for each primer
.
Output file: oligos.melttemp
CPU time: 0.04 seconds
%
MELTTEMP of oligos input from terminal November 10, 2000 10:38
[DNA] = 50.000 nM [salt] = 50.000 mM
--------------------------------------------------------------------------------
Oligo: 1
oligo (20-mer): ACCCTTCAGCAGTTCCACAC
oligo %GC: 55.0
oligo Tm (degrees Celsius): 54.3
--------------------------------------------------------------------------------
Oligo: 2
oligo (20-mer): AAGCACCCTTCAGCAGTTCC
oligo %GC: 55.0
oligo Tm (degrees Celsius): 54.7
--------------------------------------------------------------------------------
Oligo: 3
oligo (19-mer): AAGAGAGGTGGAAATGAGG
oligo %GC: 47.4
oligo Tm (degrees Celsius): 47.9
--------------------------------------------------------------------------------
By using the -PRImers parameter, you can tell MeltTemp to obtain the oligonucleotide sequences from a file instead of interactively from the keyboard. The format of this file is very similar to that of the enzyme data files described in Appendix VII that are used for the mapping programs.
The file format is field based. The exact spacing between each field does not matter; only the order of the fields in the line is significant. Blank lines and lines that start with an exclamation point ( ! ) are ignored.
The sequence names field should not have more than 31 characters. While the offset field is ignored by MeltTemp, this field must have a number in it as a placeholder to make the file compatible with the enzyme file format. The sequences may contain any valid nonambiguous GCG sequence symbols (see Appendix III) and the single quotation mark ( ' ) and underscore ( _ ) characters. Single quotation marks and underscores in the sequence patterns are ignored. MeltTemp ignores oligonucleotide sequences that contain any other characters. The overhang field used in the enzyme file format has no significance to MeltTemp and can be omitted. (For the GCG mapping programs, if the overhang field is absent or is a non-numeric character, the bottom strand of the sequence is not searched.)
Here is an example:
Name Offset Sequence Documentation .. x13598 1 ACCCTTCAGCAGTTCCACAC ! x24332 1 AAGCACCCTTCAGCAGTTCC ! u35982 1 AAGAGAGGTGGAAATGAGG !
Prime selects oligonucleotide primers for a template DNA sequence. The primers may be useful for the polymerase chain reaction (PCR) or for DNA sequencing. You can allow Prime to choose primers from the whole template or limit the choices to a particular set of primers listed in a file. PrimePair evaluates individual primers to determine their compatibility for use as PCR primer pairs. You can provide the primers in files (one for forward, one for reverse primers) or on the command line, or you can enter them interactively from the keyboard. The GCG mapping programs Map, MapPlot, and MapSort can be used to mark finds in the context of a DNA restriction map. FindPatterns identifies sequences that contain short patterns like GAATTC or YRYRYRYR. You can define the patterns ambiguously and allow mismatches. You can provide the patterns in a file or simply type them in from the terminal.
Sequences longer than 100 bases or shorter than two bases are rejected.
MeltTemp determines oligonucleotide melting temperatures using the nearest-neighbor model of Borer, and thermodynamic parameters for DNA nearest-neighbor interactions and the salt dependence of oligonucleotides determined by SantaLucia (Proc.Natl. Acad. Sci. USA. 95; 1460-1465 (1986)):
T(m)(oligo) = delta H / ((delta S' + R x ln(c/4)) - 273.15
where delta H is the enthalpy of helix formation, delta S' is the salt-adjusted entropy of helix formation (including helix initiation), R is the molar gas constant (1.987 cal/degree Celsius/mol), and c is the oligonucleotide concentration.
The salt-adjusted delta S' is determined from the delta S at 1M salt according to the equation:
delta S' = delta S + (0.368 x (oligo_length - 1) x ln[K(+)])
where [K(+)] is the potassium ion concentration.
MeltTemp does not accept ambiguous bases, since the thermodynamics for these cases are not completely understood. Sequences containing ambiguous bases are rejected.
MeltTemp only determines melting temperatures for DNA oligonucleotides. It does not currently consider formamide concentration in determining melting temperatures.
All parameters for this program may be added to the command line. Use -CHEck to view the summary below and to specify parameters before the program executes. In the summary below, the capitalized letters in the parameter names are the letters that you must type in order to use the parameter. Square brackets ([ and ]) enclose parameter values that are optional. For more information, see "Using Program Parameters" in Chapter 3, Using Programs in the User's Guide.
Minimal Syntax: % melttemp -OLIgos=acccttcagcagttccacac -Default
Prompted Parameters:
[-OUTfile1=]oligos.tm names the output file
Local Data Files:
-DATa1=dnastack.dh assigns enthalpies for DNA melting temperature
determination
-DATa2=dnastack.ds assigns entropies for DNA melting temperature
determination
Optional Parameters:
-PRImers=oligos.dat assigns oligos from a file
-DNAconcentration=50.0 sets the oligo DNA concentration (nM)
-SALtconcentration=50.0 sets the salt concentration (mM)
-NOMONitor suppresses screen trace of program progress
-NOSUMmary suppresses screen summary at the end of the program
-BATch submits program to the batch queue
The files described below supply auxiliary data to this program. The program automatically reads them from a public data directory unless you either 1) have a data file with exactly the same name in your current working directory; or 2) name a file on the command line with an expression like -DATa1=myfile.dat. For more information see Chapter 4, Using Data Files in the User's Guide.
MeltTemp reads the files dnastack.ds and dnastack.dh for the DNA stacking entropies and enthalpies, respectively, used to calculate oligonucleotide melting temperatures.
You can set the parameters listed below from the command line. For more information, see "Using Program Parameters" in Chapter 3, Using Programs in the User's Guide.
specifies an input file that contains oligonucleotide sequences.
specifies the nM concentration of DNA in the reaction. This value is used in the calculation of the melting temperature. The default value is 50.0 and the value may range from 0.1 to 50.0.
specifies the mM salt concentration in the reaction. The default value is 50.0 and the value may range from 0.1 to 50.0.
This program normally monitors its progress on your screen. However, when you use -Default to suppress all program interaction, you also suppress the monitor. You can turn it back on with this parameter. If you are running the program in batch, the monitor will appear in the log file.
writes a summary of the program's work to the screen when you've used -Default to suppress all program interaction. A summary typically displays at the end of a program run interactively. You can suppress the summary for a program run interactively with -NOSUMmary.
You can also use this parameter to cause a summary of the program's work to be written in the log file of a program run in batch.
submits the program to the batch queue for processing after prompting you for all required user inputs. Any information that would normally appear on the screen while the program is running is written into a log file. Whether that log file is deleted, printed, or saved to your current directory depends on how your system manager has set up the command that submits this program to the batch queue. All output files are written to your current directory, unless you direct the output to another directory when you specify the output file.
[ Program Manual | User's Guide | Data Files | Databases ]
Technical Support: support-us@accelrys.com
or support-eu@accelrys.com
Copyright (c) 1982-2002 Accelrys Inc. A subsidiary of Pharmacopeia, Inc. All rights reserved.
Licenses and Trademarks Wisconsin Package is a trademark and GCG and the GCG logo are registered trademarks of Accelrys Inc.
All other product names mentioned in this documentation may be trademarks, and if so, are trademarks or registered trademarks of their respective holders and are used in this documentation for identification purposes only.